View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7105_high_12 (Length: 234)
Name: NF7105_high_12
Description: NF7105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7105_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 22 - 217
Target Start/End: Complemental strand, 5352705 - 5352508
Alignment:
| Q |
22 |
aatacctacatcaatttgt--acaaccttgaccattgtgagnnnnnnnttccatattccatttctaatcctttgagagagaaaaaactatgtaactgagt |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352705 |
aatacctacatcaatttgtgtacaaccttgaccattgtgagaaaaaaattccatattccatttctaatcctttgagagagaaaaaactatgtaactgagt |
5352606 |
T |
 |
| Q |
120 |
tgagagagatttataatcttcaaagagattgataaatggttgttgtcgagtagattatagcacattgctcaatgctttatgttcgaaccaagtatatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352605 |
tgagagagatttataatcttcaaagagattgataaatggttgttgtcgagtagattatagcacattgctcaatgctttatgttcgaaccaagtatatt |
5352508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University