View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7105_high_6 (Length: 392)
Name: NF7105_high_6
Description: NF7105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7105_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 49 - 379
Target Start/End: Complemental strand, 41879115 - 41878785
Alignment:
| Q |
49 |
tcaatgaagagattaattagcaaccaaacgaggatgaacatcaactctagcaacaccatctctttccccaccaaccttagcaacatcaacctcaccaaca |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41879115 |
tcaatgaagagattaattagcaaccaaacgaggatcaacatcaactctagcaacaccatctctttccccaccaaccttagcaacatcaacatcaccaaca |
41879016 |
T |
 |
| Q |
149 |
atcaactccttagcagcatcctctccatcttcctcgtctacataattaggatcattctcatccatagccgccggcgccggatcaagcatattatcaacca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41879015 |
atcaactccttagcagcatcctctccatcttcctcgtctacataattaggatcattctcatccatagccgccggcgccggatcaagcatattatcaacca |
41878916 |
T |
 |
| Q |
249 |
tatcagccggaccttcccaagtaaacttaccaccacgaccagacttcggcggtccgcggccaatgcctatgccgtcgacagggtggcggtccagacgttg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41878915 |
tatcagccggaccttcccaagtaaacttaccaccacgaccagacttcggcggtccacggccaatgcctatgccgtcgacagggtggcggtccagacgttg |
41878816 |
T |
 |
| Q |
349 |
gacaccgttgttgatgagtttcttctccaca |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41878815 |
gacaccgttgttgatgagtttcttctccaca |
41878785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University