View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7105_high_8 (Length: 331)
Name: NF7105_high_8
Description: NF7105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7105_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 7 - 310
Target Start/End: Original strand, 7440228 - 7440523
Alignment:
| Q |
7 |
agcagaacctgtggaattccacccaaaaacaaagtagaaccaagttgaacaggataggctaatgaatcttttttctcatcattcttatttaacaatttaa |
106 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7440228 |
agcagaaccagtagaattccacccaaaaacaaagtagaaccaagttgaacaggataggctaatgaatcttttttctcatcattctta------------- |
7440314 |
T |
 |
| Q |
107 |
actaataatcttatagttgtgttttgttcggaactttatccgcgtgctgcaccgnnnnnnnnn---------ggtattgtccgtttttggtattaaaacg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7440315 |
----ataatcttatagttgtgttttgttcggaacttaatccacgtgctgcaccgtttttttttttgttttttggtattgtccgtttttggtattaaaacg |
7440410 |
T |
 |
| Q |
198 |
tgctagagtttagaagagtgtctcgttataaactactcttaatcttcatttctaagactgttagactttcttttgtaatggaatcgtaccccacaatcaa |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7440411 |
tgctagagtttagaagagtgtctcgttataaactactcttaatcttcatttctaagactgttatactttcttttgtaatggaatcgtaccccacaatcaa |
7440510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University