View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7105_low_13 (Length: 227)
Name: NF7105_low_13
Description: NF7105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7105_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 51418489 - 51418300
Alignment:
| Q |
19 |
aaatacatatcagcatcacgtggacggcacgtgagtgcttcatggtgcttcaccatcacgttgttcagtgctttccctatgttttttcctctcttcatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51418489 |
aaatacatatcagcatcacgtggacggcacgtgagtgcttcatggtgcttcaccatcacgttgttcagtgctttccctatgttttttcctctcttcatca |
51418390 |
T |
|
| Q |
119 |
cttcttgcatatcctgcataactctatgactcttagagacaccgttttgtatcagaaaacctagtaaacgcacagttttgctcactttct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51418389 |
cttcttgcatatcctgcataactctatgactcttagagacaccgttttgtatcagaaaacctagtaaacgcacagttttgctcactttct |
51418300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 11 - 208
Target Start/End: Complemental strand, 51413444 - 51413247
Alignment:
| Q |
11 |
gtgagatgaaatacatatcagcatcacgtggacggcacgtgagtgcttcatggtgcttcaccatcacgttgttcagtgctttccctatgttttttcctct |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
51413444 |
gtgaaatgaaatacatatcagcatcacgtggtcggcacgtgagtgcttcatggtgcttcaccatcacgctgttcaatgctttccctatgtttttccctct |
51413345 |
T |
|
| Q |
111 |
cttcatcacttcttgcatatcctgcataactctatgactcttagagacaccgttttgtatcagaaaacctagtaaacgcacagttttgctcactttct |
208 |
Q |
| |
|
||||||||||||||||||||| || || ||||| | ||||||||||||||||||||||| || ||||||||||||||||| |||||||||| ||||| |
|
|
| T |
51413344 |
cttcatcacttcttgcatatcttgtatcactctgttactcttagagacaccgttttgtaacatgaaacctagtaaacgcaccgttttgctcaatttct |
51413247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 29323740 - 29323690
Alignment:
| Q |
18 |
gaaatacatatcagcatcacgtggacggcacgtgagtgcttcatggtgctt |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
29323740 |
gaaatacatatcagcatcacgtggacggcacatgagtgcttcgtggtgctt |
29323690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 86 - 130
Target Start/End: Complemental strand, 29323695 - 29323651
Alignment:
| Q |
86 |
gtgctttccctatgttttttcctctcttcatcacttcttgcatat |
130 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
29323695 |
gtgctttccctatatttttacctctcttcatcacttcttgcatat |
29323651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University