View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7105_low_14 (Length: 216)
Name: NF7105_low_14
Description: NF7105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7105_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 8020383 - 8020568
Alignment:
| Q |
15 |
agctttaactttttctttgtcatgattgttacacacttgattctgtctctttttctttgtttgtcaattattattgcaagatattatatgttttcagaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8020383 |
agctttaactttttctttgtcatgattgttacacacttgattctgtctctttttctttgtttgtcaattattattgcaagatattatatgttttcagaaa |
8020482 |
T |
 |
| Q |
115 |
tatatagtgtagcagcctttaattaactaaagggccannnnnnnaatgcaaacattttggataataaagtttacttaaggtttcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8020483 |
tatatagtgtagcagcctttaattaactaaagggccatttttttaatgcaaacattttggataataaagtttacttaaggtttcat |
8020568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University