View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7106_low_3 (Length: 241)

Name: NF7106_low_3
Description: NF7106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7106_low_3
NF7106_low_3
[»] chr2 (1 HSPs)
chr2 (35-74)||(1548419-1548458)


Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 74
Target Start/End: Original strand, 1548419 - 1548458
Alignment:
35 ttgtcaactctagagagatgagcaacttcaatgttagcct 74  Q
    ||||||||| ||||||||||||||||||||||||||||||    
1548419 ttgtcaactgtagagagatgagcaacttcaatgttagcct 1548458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University