View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7106_low_5 (Length: 206)
Name: NF7106_low_5
Description: NF7106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7106_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 2213478 - 2213649
Alignment:
| Q |
20 |
gttgaatataaagggcaataagttgtttcttgagtgaaactctgtttcatcttttgaatgtctactttctacagtgttctgcttctattatttattgctc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2213478 |
gttgaatataaagggcaataagttgtttcttgattgaaactctgtttcatcttttgaatgtctactttctacagtgttctgcttctattatttattgctc |
2213577 |
T |
 |
| Q |
120 |
ttgtgctttcgcagtgctgttagtggacatccctggtcgccttgttatagtattccttttactagcttcttc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2213578 |
ttgtgctttcgcagtgctgttagtggacatccctggtcgccttgttatagtattccttttactagcttcttc |
2213649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 20 - 120
Target Start/End: Original strand, 2200827 - 2200932
Alignment:
| Q |
20 |
gttgaatataaagggcaataagttgt-----ttcttgagtgaaactctgtttcatcttttgaatgtctactttctacagtgttctgcttctattatttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
2200827 |
gttgaatataaagggcaataagttgtgttctttctggattgaaactctgtttcatcttttgaatgtctactttctacggtgttctgcttctatgatttat |
2200926 |
T |
 |
| Q |
115 |
tgctct |
120 |
Q |
| |
|
|||||| |
|
|
| T |
2200927 |
tgctct |
2200932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University