View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7107_high_14 (Length: 267)
Name: NF7107_high_14
Description: NF7107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7107_high_14 |
 | |
|
| [»] scaffold0607 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 60 - 187
Target Start/End: Original strand, 19067574 - 19067701
Alignment:
| Q |
60 |
catggtgtgttattgggatcttgaatgacattctgacggtggaagnnnnnnnggaagatcagggaggcaaccttatttaattcaaagctttcgacaagca |
159 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||| |||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
19067574 |
catggtgtgttattggggacttgaatgacattcagacagtggaagaaaaaaaggaagatcagggaggcaaccttctttatttcaaagctttcgacaagca |
19067673 |
T |
|
| Q |
160 |
gttcttgatgctggtcttattgatattc |
187 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
19067674 |
gttcttgatgctggtcttattaatattc |
19067701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 139 - 222
Target Start/End: Original strand, 32953955 - 32954038
Alignment:
| Q |
139 |
attcaaagctttcgacaagcagttcttgatgctggtcttattgatattccaatggaggggtattctttcacttggttcaaaagt |
222 |
Q |
| |
|
|||||| ||||||||||||| ||| | |||||||| ||| ||||||||| ||||| || ||| |||||||||||||||||||| |
|
|
| T |
32953955 |
attcaaggctttcgacaagctgttttggatgctggacttgctgatattcctatggatggttatgctttcacttggttcaaaagt |
32954038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 166 - 227
Target Start/End: Original strand, 16322044 - 16322105
Alignment:
| Q |
166 |
gatgctggtcttattgatattccaatggaggggtattctttcacttggttcaaaagtttagg |
227 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
16322044 |
gatgctggtcttattgatatgcatatggaggggtacccattcacgtggttcaaaagtttagg |
16322105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0607 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0607
Description:
Target: scaffold0607; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 7058 - 7114
Alignment:
| Q |
166 |
gatgctggtcttattgatattccaatggaggggtattctttcacttggttcaaaagt |
222 |
Q |
| |
|
|||| ||| ||||||||||||| ||||| || ||| |||||||||||||||||||| |
|
|
| T |
7058 |
gatgttggacttattgatattcatatggatggttatgctttcacttggttcaaaagt |
7114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University