View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7107_high_8 (Length: 421)
Name: NF7107_high_8
Description: NF7107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7107_high_8 |
 |  |
|
| [»] scaffold0472 (3 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0472 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 96 - 421
Target Start/End: Complemental strand, 5172 - 4854
Alignment:
| Q |
96 |
ggtgatttttatgcataaaaattatattggccattaaattttgtagaagacgacctatctcgtgcatattagagttatttcaattgaaatcatcttcttc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5172 |
ggtgatttttatgcataaaaattatattggccattaaattttgtagaagacgacctatctcgtgcatattagagttatttcaattgaaatcatcttgttc |
5073 |
T |
 |
| Q |
196 |
caacttatgagtatgatttcttcacggctgtaaatgaattgctgactgttgaaaaacaatattcatccttgcacttctaaaattagtgttttaggttagt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5072 |
caacttatgagtatgatttcttcacggctgtaaatgaattgctgactgttgaaaaacaatattcatccttgc--------aattagtgttttaggttagt |
4981 |
T |
 |
| Q |
296 |
tgccctttttgacttgatatagcactcctattgtttctggcaaaaagtgtcttttattcc----nnnnnnnnnnnnggaaaagtatgccttctttttctt |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4980 |
tgccctttttgacttgatatagcactcctattgtttctggcaaaaagtgtcttttattccaaaaaaaaaagaagaaggaaaagtatgccttctttttctt |
4881 |
T |
 |
| Q |
392 |
tgagtcaataatatagtgtcccgacttaat |
421 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
4880 |
tgagtc---aatatagtgtcccgacttaat |
4854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 203 - 271
Target Start/End: Original strand, 11418 - 11486
Alignment:
| Q |
203 |
tgagtatgatttcttcacggctgtaaatgaattgctgactgttgaaaaacaatattcatccttgcactt |
271 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11418 |
tgagtatgatttcttgacggctgtaaacgaattgctgactgttgaaaaacaatatccatccttgcactt |
11486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 119 - 162
Target Start/End: Original strand, 11266 - 11309
Alignment:
| Q |
119 |
atattggccattaaattttgtagaagacgacctatctcgtgcat |
162 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
11266 |
atattgtccattaaattttgtaggagaccacctatctcgtgcat |
11309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University