View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7109_high_10 (Length: 304)
Name: NF7109_high_10
Description: NF7109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7109_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 291
Target Start/End: Complemental strand, 29607215 - 29606928
Alignment:
| Q |
16 |
agtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttctta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607215 |
agtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttctta |
29607116 |
T |
 |
| Q |
116 |
tgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgct------------ggtgtgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29607115 |
tgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgt |
29607016 |
T |
 |
| Q |
204 |
ctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttcttttcgtgtgt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29607015 |
ctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgt |
29606928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University