View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7109_high_11 (Length: 284)
Name: NF7109_high_11
Description: NF7109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7109_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 20 - 278
Target Start/End: Complemental strand, 10117660 - 10117399
Alignment:
| Q |
20 |
aaaaccttggccatttaaaccggcgaat-gaatccttgttgcttctaaaccctatttgcttccaaccctagctgttagttaccgtcactc--------cg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
10117660 |
aaaaccttggccatttaaaccggcgaatagaatccttgttgcttctaaaccctatttgcttctaaccctagctgttagttaccgtcactcactgttgccg |
10117561 |
T |
 |
| Q |
111 |
tgcaaaaacaacgtgcacaaaagaatgtctgagcccgaaatttctaagtcggcagcggataggatcagcagtttacccgac---atactgattcacatcc |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10117560 |
tgcaaaaacaa---------aagaatgtctgagcccgaaatttcgacatcggcagcggataggatcagcagtttacccgacgatatactgattcacatcc |
10117470 |
T |
 |
| Q |
208 |
tctcttgcgatggttctagaaaaatgtccaatccttgaagatcttcaactatctgatatacacaggttctg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10117469 |
tctcttgcgatggttctagaaaaatgtccaatccttgaagatcttcaactatctgatatacacagtttctg |
10117399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 88
Target Start/End: Complemental strand, 1446917 - 1446877
Alignment:
| Q |
48 |
gaatccttgttgcttctaaaccctatttgcttccaacccta |
88 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
1446917 |
gaatcgttgatgcttctaaaccctattagcttccaacccta |
1446877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University