View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7109_high_14 (Length: 256)
Name: NF7109_high_14
Description: NF7109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7109_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 240
Target Start/End: Complemental strand, 11635248 - 11635021
Alignment:
| Q |
13 |
aatataagcaattgaaatatatacaagaaaaaagattcttttatcaattattattacttctcaactatgaattcaaggagctcatctgtggcaaaatact |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11635248 |
aatatacgcaattgaaatatatacaagaaaaaagattcttttatcaattattattacttctcaactatgaattcaaggagctcatctgtggcaaaatact |
11635149 |
T |
 |
| Q |
113 |
caacagaaatctcttctaaatgaccgcagcttcgttcaacagcataatgacagatctctggcaaatttgcattaaagtaactgcaatcacctatcatgcg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11635148 |
caacagaaatctcttctaaatgaccgcagcttcgttcaacagcataatgacagatctctgggaaatttgcattaaagtaactgcgttcacctatcatgcg |
11635049 |
T |
 |
| Q |
213 |
aatggtacgccacatgagaggatccttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
11635048 |
aatggtacgccacatgagaggatccttg |
11635021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 65 - 159
Target Start/End: Complemental strand, 29857090 - 29856996
Alignment:
| Q |
65 |
attacttctcaactatgaattcaaggagctcatctgtggcaaaatactcaacagaaatctcttctaaatgaccgcagcttcgttcaacagcataa |
159 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| || || ||||||||| | || ||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
29857090 |
attacttctcagctatgaattcaaggagttcatcagttacagaatactcaatattgatgtcttcaagatgaccgcaacttcgttcaacagcataa |
29856996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 239
Target Start/End: Complemental strand, 29649126 - 29649092
Alignment:
| Q |
205 |
atcatgcgaatggtacgccacatgagaggatcctt |
239 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
29649126 |
atcatgtgaatggtacgccacatgagaggatcctt |
29649092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University