View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7109_high_16 (Length: 254)
Name: NF7109_high_16
Description: NF7109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7109_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 5051010 - 5051235
Alignment:
| Q |
1 |
cataacagcagaggagttgcttcatcgtaagaaatgcccaagcatgatattctttgaagaggaacgaacaacaattggctgcttctttaatttcctagca |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5051010 |
cataacagcagaggatttgcttcatcgtaagaaatgcccaagcatgatattctttgaagaggaacgaacaacaataggctgcttctttaatttcctagca |
5051109 |
T |
|
| Q |
101 |
attatgaaaaacatcgaccattatgaaaaataagaccgaacgttttaaacatcaacatcaacaaaaagtagaataaattgttattaattattaaaaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5051110 |
attatgaaaaacatcgaccattatgaaaaataagaccgaaccttttaaacatcaacatcaacaaaaagtagaataaattgttatt-----------aatt |
5051198 |
T |
|
| Q |
201 |
tgttcttataagtgaatgtctaaacactataagtttg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5051199 |
ggttcttataagtgaatgtctaaacactataagtttg |
5051235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University