View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7109_high_17 (Length: 216)
Name: NF7109_high_17
Description: NF7109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7109_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 26 - 206
Target Start/End: Original strand, 49436139 - 49436321
Alignment:
| Q |
26 |
cacaaattcgatcgtaaccgaaaggatgagaaacgacgagaagctccaccttcacaagcagaagcttctcgaaagagagaaagatgaagtaaaatttgga |
125 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49436139 |
cacaaattcgatcgtaacagaaaggatgagaaacgacgagaagctccaccttcacaagcagaagcttctcgaaagagagaaagatgaagtaaaatttgga |
49436238 |
T |
|
| Q |
126 |
aagagaatgatatggttagtcaga--agagagaggtggaagaagagtttatatagtgacaatggtgaagagggtgtgtttgtt |
206 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49436239 |
aagagaatgatatggttagttagaagagagagaggtggaagaagagtttatatagtgacaatggtgaagagggtgtgtttgtt |
49436321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University