View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7109_low_11 (Length: 308)
Name: NF7109_low_11
Description: NF7109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7109_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 49 - 292
Target Start/End: Complemental strand, 12765650 - 12765407
Alignment:
| Q |
49 |
ataatcgaaatgtgtctgacaccatttatatcttcgctatgaagcattgatgttatacaccttaactaatttttcaattactgattttaggttaattacc |
148 |
Q |
| |
|
|||||| ||||||||| ||||||||| ||||||||||||| ||| ||||| |||||||| | |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12765650 |
ataatcaaaatgtgtcggacaccattcatatcttcgctataaagtgttgatattatacacgtcaactaatttttcaattgctgattttaggttaattacc |
12765551 |
T |
|
| Q |
149 |
tttttagggatgcctataaaagtaagagatggagaaagtaaagggtggaaagtgtgctcatacaaaggccccactctgtcatcttctataaccaccattc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12765550 |
tttttagggatgcctataaaagtaagagatggagaaagtaaagggtggaaagtgtgctcatacaaaggccccactctgtcatcttctataaccaccattc |
12765451 |
T |
|
| Q |
249 |
ctttggtgtcaagaaaagggaagctataggagtacctacaaaac |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12765450 |
ctttggtgtcaagaaaagggaagctataggagtacctacaaaac |
12765407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 73
Target Start/End: Complemental strand, 12765801 - 12765744
Alignment:
| Q |
16 |
atacgagtctttaatcagaattgtgaatgtaagataatcgaaatgtgtctgacaccat |
73 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12765801 |
atacgagtcttcaatcagaattgtgaatgtaagataatcgaaatgtgtcggacaccat |
12765744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University