View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7110_low_4 (Length: 357)
Name: NF7110_low_4
Description: NF7110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7110_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 19 - 349
Target Start/End: Original strand, 8288165 - 8288495
Alignment:
| Q |
19 |
atttgatcagcgagtttctcttgagagagtgaatcggattcagtgtggatttgagtcgggtcgggtaaacgcggaacggttgagatgattctagaaagtg |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8288165 |
atttgatcggcgagtttctcttgagagagtgaatcggattccgtatggatttgagtcgggtcgggtaaacgcggaacggtggagatgattctagaaagtg |
8288264 |
T |
|
| Q |
119 |
ttgaatggtttccgattgcgacggcgtaatgaactggactgtgtaaatattgttctggtttgagttcacggcgaaacgatgtcgtttgagggtttccttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288265 |
ttgaatggtttccgattgcgacggcgtaatgaactggactgtgtaaatattgttctggtttgagttcacggcgaaacgatgtcgtttgagggtttccttt |
8288364 |
T |
|
| Q |
219 |
cgtcatttcaatttcgatctcgatcataacaatgaaattgagagaggggaagagtgttactgtgaatatggtatgcttaatttgagtttgaggaatttgg |
318 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8288365 |
cgtcatttcgatttcgatctcgatcataacaatgaaattgagagaggggaagagtgttactgtgaatatgctatgcttaatttgagtttgaggaatttgg |
8288464 |
T |
|
| Q |
319 |
ggtcacgtgtttttctcattcttttcttttc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8288465 |
ggtcacgtgtttttctcattcttttcttttc |
8288495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University