View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7110_low_7 (Length: 272)
Name: NF7110_low_7
Description: NF7110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7110_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 25256340 - 25256580
Alignment:
| Q |
10 |
agcagagaagcaaagaataacaataacccatctcttaggaaaaacttcccaccaaggtgaagactcagtcacttcttcctcaacagcaacagcatccaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25256340 |
agcagagaagcaaagaataacaataacccatctcttaggaaaaacttcccaccaagatgaagactcagtcacttcttcctcaacatcaacaccatccaaa |
25256439 |
T |
 |
| Q |
110 |
ccacttactactttcttatgaactgcaagatcttgatacttacttgaggcttctggcccatgtttctcagacttaacatctgcccacaccttccctcttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25256440 |
ccacttactactttcttatgaactgcaagatcttgatacttacttgaggcttctggcccatgtttctcagacttaacatctgcccacaccttccctcttc |
25256539 |
T |
 |
| Q |
210 |
ccctccggtgagacagcagcaggtgcaatggaaacggagaaggt |
253 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
25256540 |
ccctccggtgaca---cagcaggtgcaatggaaacggataaggt |
25256580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University