View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7111_high_1 (Length: 256)
Name: NF7111_high_1
Description: NF7111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7111_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 2502589 - 2502365
Alignment:
| Q |
18 |
aaaatggctccttgaattccatcttgctgctgcaaaagcgaatcatcacggcgtttcgacgacactaacaccggcggagaagccgccaccgccgacgacg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2502589 |
aaaatggctccttgaattccatcttgctgctgcaaaagcgaatcatcacggcgtttcgacgacactaacaccggcggagaagccgccactgccgacgacg |
2502490 |
T |
 |
| Q |
118 |
cagaacggctcttccctaaatgtttgtaaacaactctaagccctgccggaatattattcccctgtttctgactctgagtcttagcattgttttcttcatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2502489 |
cagaacggctcttccctaaatgtttgtaaacaactctaagccctgccggaatattattcccctgtttctgactctgagtcttagcattgttttcttcatt |
2502390 |
T |
 |
| Q |
218 |
ttcagctacggtttcaccttccgtc |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2502389 |
ttcagctacggtttcaccttccgtc |
2502365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University