View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7111_high_2 (Length: 228)

Name: NF7111_high_2
Description: NF7111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7111_high_2
NF7111_high_2
[»] chr5 (2 HSPs)
chr5 (60-217)||(38051179-38051339)
chr5 (152-214)||(38056018-38056081)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 60 - 217
Target Start/End: Complemental strand, 38051339 - 38051179
Alignment:
60 ataagattatctgttacattttttagtgggtgttagnnnnnnncaattagaatatctaaactatttttaggaaaatgggtacaaaacttacttttgaaat 159  Q
    ||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
38051339 ataagattatctgttacattttttagtgggtgttagtttttttcaattagaatatctaaactatttttaagaaaatgggtacaaaacttacttttgaaat 38051240  T
160 aaaaaatcaattgattttattattttgctctatagaaacaaa---tttagatgaatgtgat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||    
38051239 aaaaaatcaattgattttattattttgctctatagaaacaaatattttagatgaatgtgat 38051179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 38056081 - 38056018
Alignment:
152 tttgaaataaaaaa-tcaattgattttattattttgctctatagaaacaaatttagatgaatgt 214  Q
    |||||||||||||| |||||||||||| |||||||| || ||| ||||||||||||||||||||    
38056081 tttgaaataaaaaaatcaattgattttgttattttgttcaataaaaacaaatttagatgaatgt 38056018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University