View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7113_high_36 (Length: 273)

Name: NF7113_high_36
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7113_high_36
NF7113_high_36
[»] chr1 (1 HSPs)
chr1 (146-242)||(3929116-3929211)
[»] chr4 (2 HSPs)
chr4 (150-257)||(6354666-6354772)
chr4 (148-232)||(23531119-23531202)
[»] chr2 (2 HSPs)
chr2 (176-255)||(44911970-44912049)
chr2 (146-184)||(23244852-23244890)
[»] chr5 (1 HSPs)
chr5 (146-184)||(6437366-6437404)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 146 - 242
Target Start/End: Complemental strand, 3929211 - 3929116
Alignment:
Q  146 aatgagaggatgagaggatcaaatggtgaccattggatcaaatatttactatgatctctaacttttataaccacagcataatcttttcagcctttca 242  Q
    ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
T  3929211 aatgagaggatgagaggatcaaatggtgaccattggatcaa-tctttactatgatctctaacttttataaccacagcgtaatcttttcaccctttca 3929116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 150 - 257
Target Start/End: Complemental strand, 6354772 - 6354666
Alignment:
Q  150 agaggatgagaggatcaaatggtgaccattggatcaaatatttactatgatctctaacttttataaccacagcataatcttttcagcctttcaattcatc 249  Q
    |||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||   |||| |||||||||||||  ||||||    
T  6354772 agaggatgagagaatcaaatggtgaccattggatcaa-tctttactatgatctctaacttttataaccacattgtaatattttcagcctttcgtttcatc 6354674  T
Q  250 cctttgtg 257  Q
    ||||||||    
T  6354673 cctttgtg 6354666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 232
Target Start/End: Original strand, 23531119 - 23531202
Alignment:
Q  148 tgagaggatgagaggatcaaatggtgaccattggatcaaatatttactatgatctctaacttttataaccacagcataatctttt 232  Q
    ||||||| ||||||||||||||  |||||||||||| |||| ||||| ||||| | ||| ||| |||||  |||| |||||||||    
T  23531119 tgagagggtgagaggatcaaatcctgaccattggat-aaatctttaccatgatgtttaattttaataactgcagcttaatctttt 23531202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 176 - 255
Target Start/End: Complemental strand, 44912049 - 44911970
Alignment:
Q  176 cattggatcaaatatttactatgatctctaacttttataaccacagcataatcttttcagcctttcaattcatccctttg 255  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||  ||||||||||||    
T  44912049 cattggatcaaatctttactatgatctctaacttttataaccacagcgtaatcttttcagcctttcgtttcatccctttg 44911970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 184
Target Start/End: Original strand, 23244852 - 23244890
Alignment:
Q  146 aatgagaggatgagaggatcaaatggtgaccattggatc 184  Q
    ||||||||| ||||| |||||||||||||||||||||||    
T  23244852 aatgagagggtgagatgatcaaatggtgaccattggatc 23244890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 184
Target Start/End: Complemental strand, 6437404 - 6437366
Alignment:
Q  146 aatgagaggatgagaggatcaaatggtgaccattggatc 184  Q
    ||||||||| ||||| |||||||||||||||||||||||    
T  6437404 aatgagagggtgagatgatcaaatggtgaccattggatc 6437366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University