View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7113_high_48 (Length: 248)

Name: NF7113_high_48
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7113_high_48
NF7113_high_48
[»] chr5 (1 HSPs)
chr5 (1-233)||(7720562-7720794)


Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 7720562 - 7720794
Alignment:
1 actgctccaaaaaagcaaagttgtgatgggttttagattccaggcacgaggttactatcatgacgaacttggcttagattcattcacgtgattcccattg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7720562 actgctccaaaaaagcaaagttgtgatgggttttagattccaggcacgaggttactatcatgacgaacttggcttagattcattcacgtgattcccattg 7720661  T
101 tacgagtggccataggtagaagaaacaactggttgttgttgtgattgtttgttgctgctggattggatgcgatggtctattataactactaacggagggg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7720662 tacgagtggccataggtagaagaaacaactggttgttgttgtgattgtttgttgctgctggattggatgcgatggtctattataactactaacggagggg 7720761  T
201 atgtttgaggagtggtcattgttatgttgaaat 233  Q
    |||||||||||||||||||||||||||||||||    
7720762 atgtttgaggagtggtcattgttatgttgaaat 7720794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University