View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_high_51 (Length: 240)
Name: NF7113_high_51
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 4937341 - 4937127
Alignment:
| Q |
9 |
cgaagaatatctcatgagagttatctttcgatgatgttaaaactgaacaaacaccattaaaaagttatctattgattgattataggggtttaaaaagcaa |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4937341 |
cgaaaaatatctcatgagagttatctttcgatgatgttaaaactgaacaaacaccattaaaaagttatctattgaatgattataggggtttaaaaagcac |
4937242 |
T |
 |
| Q |
109 |
aactcattattctatttctatgtcttattctttaggccaggcccattaagcttcctattaggacccgaccagtaatataaggtgtcaatttgttttagta |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
4937241 |
aactcattattctatttctatgtcttgttctttaggccaggcccattaagcttcctattaggacccaaccagtaatataaggtgtcaatttgttttacta |
4937142 |
T |
 |
| Q |
209 |
tacaacacaactttt |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4937141 |
tacaacacaactttt |
4937127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University