View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_high_53 (Length: 239)
Name: NF7113_high_53
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_high_53 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 29534363 - 29534127
Alignment:
| Q |
17 |
aaatcagcaccgtccgatcttgattggacagtcaccaatgcctgactgtggggggttttgactgcagctaaacccg--------------gtcccaaaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
29534363 |
aaatcagcaccgtccgatcttgattggacagtcaccaatgcctgaccgtgggggattttgactgcagctaaacccccggtcccaaatgaagtcccaaaaa |
29534264 |
T |
 |
| Q |
103 |
tcaaaagcctactcttcaaaattctaaattgtggtcttcaattgcaattgggaccgcaagataaagattttagaatttagggtctctacaatggcaacac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
29534263 |
tcaaaagcctactcttcaaaattctaaattgcggtcttcaattgcaattgggaccgcaagataaagattttagaatttagggtctctacaacgacaacac |
29534164 |
T |
 |
| Q |
203 |
aatgacaattgcaatcgcttttggcgcgcatttcacc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29534163 |
aatgacaattgcaatcgcttttggcgcgcatttcacc |
29534127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 15418372 - 15418320
Alignment:
| Q |
124 |
ttctaaattgtggtcttcaattgcaattgggaccgcaagataaagattttaga |
176 |
Q |
| |
|
|||||||||||||||| ||| |||||||| | |||||| |||||||||||||| |
|
|
| T |
15418372 |
ttctaaattgtggtctacaactgcaattgtggccgcaatataaagattttaga |
15418320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University