View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_high_62 (Length: 213)
Name: NF7113_high_62
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_high_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 31309504 - 31309318
Alignment:
| Q |
13 |
aagaaaataacagaaattgtgaaggataaagagaagggttactttgaaaatacgatagcaggtggtgaaattcggcggcggcgacaaattgaagatttcg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31309504 |
aagaaaataacagaaattgtgaaggataaagagaagggttactttgaaaatacgatagcaggtgctgaaattcggcggcggcgacaaattgaagatttcg |
31309405 |
T |
 |
| Q |
113 |
gcagtgttcgatgaggtttatgggtttgatgatgttcaatgagttcttgatcatccagtttctgggttatcgatctggttcaatttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31309404 |
gcagtgttcgatgaggtttatgggtttgatgatgttcaatgagttcttgatcatccagattctgggttatcgatctggttcaatttg |
31309318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University