View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_23 (Length: 386)
Name: NF7113_low_23
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 18 - 373
Target Start/End: Complemental strand, 9072552 - 9072197
Alignment:
| Q |
18 |
catgataagagaccaagcaccaaacatagtaacacttgtagagcaagaagcaagccataacggaccgtactttttgggccgatttctcgaggctttgcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072552 |
catgataagagaccaagcaccaaacatagtaacacttgtagagcaagaagcaagccataacggaccgtactttttgggccgatttctcgaggctttgcat |
9072453 |
T |
|
| Q |
118 |
tactactccgcaattttcgactccttggacgccacttttcctgtggaatcagcaccaagggctaaggtggagcagtatatatttgcaccggagattcgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9072452 |
tactactccgcaattttcgactccttggacgccacttttcctgtggaatcagcaccaagggctaaggtagagcagtatatatttgcaccggagattcgga |
9072353 |
T |
|
| Q |
218 |
acatcgtggcatgtgaaggtgaagagaggatagagaggcatgagaggttggagaaatggaggaagataatggaaggaaaagggttcaaaggagtgcctct |
317 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9072352 |
acatcgtggcatgtgaaggtgaggaaagaatagagagacatgagaggttggagaaatggaggaagataatggaagggaaagggttcaaaggagtgcctct |
9072253 |
T |
|
| Q |
318 |
aagtcctaatgcagtgactcagtcaagaatattattgggtttgtattcatgtgatg |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072252 |
aagtcctaatgcagtgactcagtcaagaatattattgggtttgtattcatgtgatg |
9072197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University