View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_32 (Length: 322)
Name: NF7113_low_32
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 39944999 - 39944790
Alignment:
| Q |
1 |
ggtgtgtagagttcattatgcaatctagtagaacttattaatccaacgactcttaataatggtttaaggtgagggacttgttagagcctcaccctacaat |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944999 |
ggtgtgtagagttcattatacaatctagtagaacttattaatccaacgactcttaatgatggtttaaggtgagggacttgttagagcctcaccctacaat |
39944900 |
T |
 |
| Q |
101 |
-cacctattaattaattacccaatttcaagttgttatata----tagttatacttgtaaaatcaacacatacataaaagaattgcagcaaaactgctatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944899 |
ccacctattaattaattacccaatttcaagttgttatatatagttagttatacttgtaaaatcaacacatacataaaagaattgcagcaaaactgctatt |
39944800 |
T |
 |
| Q |
196 |
tattgatgag |
205 |
Q |
| |
|
|||||||||| |
|
|
| T |
39944799 |
tattgatgag |
39944790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 257 - 308
Target Start/End: Complemental strand, 39944738 - 39944687
Alignment:
| Q |
257 |
actcgaatctaataagaatttatcttaactaacatatatcttcaatgtaaat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944738 |
actcgaatctaataagaatttatcttaactaacatatatcttcaatgtaaat |
39944687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University