View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_40 (Length: 264)
Name: NF7113_low_40
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 211
Target Start/End: Original strand, 3146043 - 3146245
Alignment:
| Q |
9 |
gaagaaaatttaccatttctgaagattggaaagtggttaggttttggtttagaaaagtggatttgaagaaacctaaagagaggtttcagagaatagtgaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3146043 |
gaagaaaatttaccatttctgaagattggaaagtggttaggttttggtttagaaaagtggatttgaagaaacctaaagagaggtttcagagaatagtgaa |
3146142 |
T |
 |
| Q |
109 |
aatgttgagatcgatggggaagaaagagagtgtgtgtgatgatttgcagttaaggtgttggtttacgataatgccattgagaagggacagtgagtcatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3146143 |
aatgttgagatcgatggggaagaaagagagtgtgtgtgatgatttgcagttaaggtgttggtttacgataatgccattgagaagggacagtgagtcatca |
3146242 |
T |
 |
| Q |
209 |
cac |
211 |
Q |
| |
|
||| |
|
|
| T |
3146243 |
cac |
3146245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 231 - 263
Target Start/End: Complemental strand, 30586 - 30554
Alignment:
| Q |
231 |
atgagatttttacaactattttgtgacaacttt |
263 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
30586 |
atgatatttttacaactattttgtgacaacttt |
30554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University