View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_46 (Length: 253)
Name: NF7113_low_46
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 126 - 243
Target Start/End: Complemental strand, 44259328 - 44259211
Alignment:
| Q |
126 |
ataatcaaaaccccattaaagaacatgtctttcaatcaccatcaaattctatatgtagaatctaacatataaaacttggagttataaatatattatagtc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44259328 |
ataatcaaaacaccattaaagaacatgtctttcaatcaccatcaaattctatatgtagaatctaacatataaaacttggatttataaatatattatagtc |
44259229 |
T |
|
| Q |
226 |
ctcatcaatcaaatataa |
243 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44259228 |
ctcatcaatcaaatataa |
44259211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 164 - 250
Target Start/End: Complemental strand, 44253842 - 44253752
Alignment:
| Q |
164 |
ccatcaaattctatatgtagaa---tctaacatataaaacttggagttataaatatattatagtcctcatcaatc-aaatataagtttaca |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
44253842 |
ccatcaaattctatatgtagaagaatctaacatataaaaattggaattataaatatattatagtcttcatcaatcaaaatataagtttaca |
44253752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 44259373 - 44259325
Alignment:
| Q |
32 |
aatgtcgaacttgagaaaagacacgaatattagtatttgattgaaataa |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259373 |
aatgtcgaacttgagaaaagacacgaatattagtatttgattgaaataa |
44259325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University