View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_49 (Length: 250)
Name: NF7113_low_49
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 59 - 235
Target Start/End: Complemental strand, 11271811 - 11271630
Alignment:
| Q |
59 |
ataatgattttatcatttcgtctatacaataaaatatttatatattgagattcatatcnnnnnnntatactccaatatattgagattggtacgtacccat |
158 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11271811 |
ataatgactttatcatttcgtctatacaataaaatatttatatattgagattcatctcaaaaaaatatactccaatatattgagattggtacgtacccat |
11271712 |
T |
 |
| Q |
159 |
atgcaaaaacagcgaggaaagaacatatagat-----ttgacataggaaatttccaatactaacataccctattgagcaatt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
11271711 |
atgcaaaaacagcgaggaaagaacatattgatattgattgacataggaaatttcctatactaacatacccttttgagcaatt |
11271630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 83
Target Start/End: Complemental strand, 24063273 - 24063245
Alignment:
| Q |
55 |
atttataatgattttatcatttcgtctat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24063273 |
atttataatgattttatcatttcgtctat |
24063245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University