View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_53 (Length: 247)
Name: NF7113_low_53
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 37 - 231
Target Start/End: Original strand, 37145334 - 37145528
Alignment:
| Q |
37 |
tgatagataccggtttcatgttattgttatcatcatcgaaaaagagcatagagttatatggcaccccggtctttgagtgaattttctgaaaatgttctgt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37145334 |
tgatagataccggtttcatgttattgttatcatcatcgaaaaagagcatagagttatatggcaccccggtcttggagtgaattttctgaaaatgttctgt |
37145433 |
T |
 |
| Q |
137 |
tttgtgtgtagagctgtaaaatatttcctaaacaataaaaaagagaaattaaatttggacctaacaagaacttgccgtaaaataaatatacatac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
37145434 |
tttgtgtgtagagctgtaaaatatttcctaaacaataaaaaagagaaattaaatttggacctaacaacaacgtgccgtaaaataaatatacatac |
37145528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University