View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_64 (Length: 222)
Name: NF7113_low_64
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 12164947 - 12165149
Alignment:
| Q |
1 |
aagttgcagactgtgtggggtggaaagcatcccagaacacatattgtgctctgtttgcacatggaaattgcattgggagacatgatatttggcctctatt |
100 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12164947 |
aagttgcagactgcgttgggtgaaaagcatcccagaacacatattgtgctctgtttgcacatggaaattgcattgggagacatgatatttggcctctatt |
12165046 |
T |
 |
| Q |
101 |
ccttccaagaccacaacaagctctatcaataacactgaatgctgcaaccacaacaaaaaatcaccattatgaacacaaatccatcgtattcggttgaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12165047 |
ccttccaagaccacaacaagctctatcaataacactgaatgctgcaaccacaacaaaaaatcaccattatgaacacaaatccatcgtcttcggttgaata |
12165146 |
T |
 |
| Q |
201 |
aac |
203 |
Q |
| |
|
||| |
|
|
| T |
12165147 |
aac |
12165149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University