View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7113_low_67 (Length: 207)
Name: NF7113_low_67
Description: NF7113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7113_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 33998750 - 33998574
Alignment:
| Q |
18 |
atataaaagaaaagagacatgccaaaaaataataagtc--gcggaaataagggagaaactgttacaacaagtgagtgaaaattattagtgatttctctct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33998750 |
atataaaagaaaagagacatgccaaaaaataataagtcttgcggaaataagggagaaactgttagaacaagtgagtgaaaattattagtgatttctctct |
33998651 |
T |
 |
| Q |
116 |
tgttttcacgatactannnnnnncactttccaaacagtttacctctttatccagatttgtaaattcctcatttattt |
192 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33998650 |
tgttttcacgatactatttttttcactttccaaactgtttacctctttatccagatttgtaaattcctcatttattt |
33998574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University