View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7114_high_4 (Length: 289)
Name: NF7114_high_4
Description: NF7114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7114_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 7 - 155
Target Start/End: Original strand, 2529183 - 2529331
Alignment:
| Q |
7 |
ttatgagtgtgagacaccgatctgagaaagtgtatgaatgaacaaagcaatgtgattaaggaacaagatcaacagtgtgagaaaaactaagttgataaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2529183 |
ttatgagtgtgagacaccgatctgagaaagtgaatgaatgaacaaagcaatgtgagtaaggaacaagatcaacagtgtgagaaaaactaagttgataaac |
2529282 |
T |
 |
| Q |
107 |
aaacaaccttcacaactgtgtctgttgtttgtgcatgtaaaatgtatgc |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2529283 |
aaacaaccttcacaactgtgtctgttgtttgtgcatgtaaaatgtatgc |
2529331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 215 - 267
Target Start/End: Original strand, 2529391 - 2529443
Alignment:
| Q |
215 |
tgaatcaatgacatactcacttgttgttttttatcatgtaaaatgctaacgaa |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2529391 |
tgaatcaatgacatactcacttgttgttttttatcatgtaaaatgctaacgaa |
2529443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University