View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7114_high_5 (Length: 237)
Name: NF7114_high_5
Description: NF7114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7114_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 57 - 219
Target Start/End: Complemental strand, 15128565 - 15128400
Alignment:
| Q |
57 |
gttaatatattaggttttgacataaatat---gtcatgttgaaggtttcagtttttgcatgacgtattttacgtaataggttacctaccaatgataattt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15128565 |
gttaatatattaggttttgacataaatatcatgtcatgttgaaggtttcagtttttgcatgacgtcttttacgtaataggttacctaccaatgataattt |
15128466 |
T |
|
| Q |
154 |
ggctaggcgtggtgtaattactcatgaggatcttttgtgtgtgagtgggtgcggtgtggtggaaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15128465 |
ggctaggcgtggtgtaattactcatgaggatcttttgtgtgtgagtgggtgcggtgtggtggaaat |
15128400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 125 - 218
Target Start/End: Complemental strand, 29065146 - 29065055
Alignment:
| Q |
125 |
cgtaataggttacctaccaatgataatttggctaggcgtggtgtaattactcatgaggatcttttgtgtgtgagtgggtgcggtgtggtggaaa |
218 |
Q |
| |
|
|||||||||||| ||||||| |||||| ||||||||| | ||||||||||||||||||||||||| |||||||||||| ||||||| ||||| |
|
|
| T |
29065146 |
cgtaataggttatctaccaaagataatctggctaggcacgatgtaattactcatgaggatcttttg--tgtgagtgggtgtggtgtggcggaaa |
29065055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University