View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7115_low_2 (Length: 280)
Name: NF7115_low_2
Description: NF7115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7115_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 44671618 - 44671346
Alignment:
| Q |
1 |
aaatcttcatgaattgtgcagtatcagcaacggccgttccactctcagatgccagagaattctccaacaaaatagctttttgaagactcatattatcggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44671618 |
aaatcttcatgaattgtgcagtatcagcaacggccgttccactctcagatgccagagaattctccaacaaaatagctttttgaagactcatattatcagt |
44671519 |
T |
|
| Q |
101 |
agcagcagcaatgtagaatctcggtttgaacctatctttctgtaacaccgccagtagattaagcatctcggcagtatgaccacctgatcctaaaataata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44671518 |
agcagcagcaatgtagaatctcggtttgaacctatctttctgtaacaccgccaatagattaagcatctcggcagtatgaccacctgatcctaaaataata |
44671419 |
T |
|
| Q |
201 |
agggtgctgacaggttttgaagctcttttgctcaagggcctgccactactatatatgacatgaacaacacgaa |
273 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44671418 |
agggtactgacaggttttgaagctcttttgctcaagggcctgccactactatatatgacatgaacaacacgaa |
44671346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 12497504 - 12497422
Alignment:
| Q |
182 |
acctgatcctaaaataataagggtgctgacaggttttgaagctcttttgctcaagggcctgccactactatatatgacatgaa |
264 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||| |||||||||||||||||||| | || |||| |||||||||||||| |
|
|
| T |
12497504 |
acctgatcctaaaataataagagtactaacaggttttaaagctcttttgctcaagggctttccgctacgatatatgacatgaa |
12497422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 12497640 - 12497584
Alignment:
| Q |
129 |
aacctatctttctgtaacaccgccagtagattaagcatctcggcagtatgaccacct |
185 |
Q |
| |
|
||||||||||||| |||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
12497640 |
aacctatctttctctaacactgtcaacagattaagcatctcggcagtatgaccacct |
12497584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University