View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7115_low_5 (Length: 334)
Name: NF7115_low_5
Description: NF7115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7115_low_5 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 108 - 334
Target Start/End: Original strand, 27771 - 27997
Alignment:
| Q |
108 |
cctttttatccggccttcctgttttaatcatggttaaattcaagaaagccgtgccattttcagtacagaatgttgtttttctcctcgtacaatgtagtga |
207 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| || |||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27771 |
cctttatatctggccttcctgttttaatcatggtcaagttcaagaacttcgtgtcattttcagtacagaatgttgtttttctcctcgtacaatgtcgtga |
27870 |
T |
 |
| Q |
208 |
agaatcttcctctccgtggttatcattgtagaatcctggtaaacatttgcaaacgctatcatcgtcattacagctagcaaagtttccacaagcattatat |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27871 |
agaatcttcctctccctggttatcattgtagaatcctggtaaacatttgcaaacgctatcatcgtcattacagctagcaaagtttccacaagcattatat |
27970 |
T |
 |
| Q |
308 |
gttaaacatttgcttcttggctgcttc |
334 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27971 |
gttaaacatttgcttcttggctgcttc |
27997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University