View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7115_low_8 (Length: 206)
Name: NF7115_low_8
Description: NF7115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7115_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 59 - 189
Target Start/End: Complemental strand, 9665567 - 9665437
Alignment:
| Q |
59 |
gaagagaaatggattagggatggtagtagtggaacgttgcttgaaagagacgacttgtaataatggaatttgaatactttaatttcagaacaagcttcac |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9665567 |
gaagagaaatggattagggatggtagtagtggaacgttgcttgaaagagacgacttgtaataatggaatttgaatactttaatttcagaacaagcttcac |
9665468 |
T |
 |
| Q |
159 |
taggaagaaaggtaagaacagagtcacaatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9665467 |
taggaagaaaggtaagaacagagtcacaatt |
9665437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University