View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7116_high_14 (Length: 398)
Name: NF7116_high_14
Description: NF7116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7116_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 25118104 - 25118271
Alignment:
| Q |
18 |
acttttgtgttgcttcctgcttgagattattaaacatgtttttaaccatatacttaaggaagttattttgtagtagtatgtatttagaagatttcttttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25118104 |
acttttgtgttgcttcctgcttgagattattaaacatgtttttaaccatatacttaaggaagttattctgtagtagtatgtatttagaagatttcttttg |
25118203 |
T |
 |
| Q |
118 |
ttatcaaaaagtttattgtcattaaaacttatgactaggaagattggtgccataaaagagtatattat |
185 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118204 |
ttatcgaaaagtttattgtcattaaaaccaatgactaggaagattggtgccataaaagagtatattat |
25118271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 148 - 176
Target Start/End: Original strand, 25118304 - 25118332
Alignment:
| Q |
148 |
atgactaggaagattggtgccataaaaga |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25118304 |
atgactaggaagattggtgccataaaaga |
25118332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University