View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7116_high_23 (Length: 307)
Name: NF7116_high_23
Description: NF7116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7116_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 31856352 - 31856129
Alignment:
| Q |
16 |
cttccttccacaatcatgcaacctgaatggattgcatgcacaatgcaagggtacataatattcatatatttttccttttgtgacaaattatgtgatgaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856352 |
cttccttccacaatcatgcaacctgaatggattgcatgcacaatgcaagggtacata--attcatatatttttccttttgtgacaaattatgtgatgaat |
31856255 |
T |
|
| Q |
116 |
tttcttcctaatcttctaattcctatgaaaattatttgtatataatatgtctaatgaatgtttttattaatttgtaaattgcagcctccggctctccttt |
215 |
Q |
| |
|
| | ||| | | || || || | | ||||| |||||||||||||||||||||| || |||||||| |||||||| |||||||| || || |||||||| |
|
|
| T |
31856254 |
tattttcttcctattttagtttcctttaaaatcatttgtatataatatgtctaataaaggtttttataaatttgtacattgcagcttctggttctccttt |
31856155 |
T |
|
| Q |
216 |
accagctccaggtatttattaattaa |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31856154 |
accagctccaggtatttattaattaa |
31856129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University