View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7116_low_10 (Length: 463)
Name: NF7116_low_10
Description: NF7116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7116_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 120 - 446
Target Start/End: Original strand, 8103068 - 8103397
Alignment:
| Q |
120 |
cctattgcctgaaaactgtttcccggtcgatgaactaatgaccttacctgccccatgcgcaaaaagttgaactattctttctataataggttggatgagt |
219 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
8103068 |
cctattgcctgaaaaccgtttccgggtcgatgaactaatgaccttacctgccccatgcgcaaaaagttgaactattctttttataataggttggataagt |
8103167 |
T |
 |
| Q |
220 |
gaattataacaatttttggggagattgatttgctaaggacgttttccatgaaatattttcttatcgttac-ttttttggttttgtcta--tgtgtaaact |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
8103168 |
gaattataacaatttttggggagattgatttgctaaggacgttttccatgaaatattttcttatcgttactttttttggttttgtctatttgtgtaaact |
8103267 |
T |
 |
| Q |
317 |
tgtaataatataaatttctctcacaattctggggtttattcaatatctacttttagaggtacaacattgttgttgagtctatgaaaaatagcttcaagag |
416 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8103268 |
tgtaataatataaatttctctcacaattatgggggttattcaatatctacttttagaggtacaacattgttgttgagtctatgaaaaacagcttcaagag |
8103367 |
T |
 |
| Q |
417 |
atttcgtatgcaattttatggtgatggaag |
446 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
8103368 |
attttgtatgcaattttatggtgatggaag |
8103397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 115
Target Start/End: Complemental strand, 51691874 - 51691837
Alignment:
| Q |
78 |
gcagagccgagcctccggattcgtaggaactgccctgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51691874 |
gcagagccgagcctccggattcgtaggaacggccctgt |
51691837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 81 - 115
Target Start/End: Complemental strand, 39134671 - 39134637
Alignment:
| Q |
81 |
gagccgagcctccggattcgtaggaactgccctgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39134671 |
gagccgagcctccggattcgtaggaacggccctgt |
39134637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 78 - 114
Target Start/End: Original strand, 18201283 - 18201319
Alignment:
| Q |
78 |
gcagagccgagcctccggattcgtaggaactgccctg |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
18201283 |
gcagagccgagcctccggattcgtgggaacggccctg |
18201319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 8420402 - 8420434
Alignment:
| Q |
1 |
tttaaaaaatttaaatagaacgttattctttta |
33 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
8420402 |
tttaaaaaatttaaatagaacattattctttta |
8420434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University