View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7116_low_11 (Length: 434)
Name: NF7116_low_11
Description: NF7116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7116_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 184 - 427
Target Start/End: Original strand, 19917576 - 19917819
Alignment:
| Q |
184 |
gataaggtgttgttggttttagacatttgtggaaaattgaaaatatctgtatttcatattctagttgtcttcttttagtagtttagaatcatgtgtttat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19917576 |
gataaggtgttgttggttttagacatttgtggaaaattgaaaatatctgtatttcatattctagttgtcttcttttagtagtttagaatcatgtgtttat |
19917675 |
T |
|
| Q |
284 |
tattgtcatgtggggtaactcaacagataattggtgtttccttgaatgggattgatgttggatgctgagccagtaactttgtattgtatctttgtttgga |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19917676 |
tattgtcatgtggggtaactcaacagataattggtgtttccttgaatgggattgatgttggatgcagagccagtaactttgtattgtatctttgtttgga |
19917775 |
T |
|
| Q |
384 |
atactagcatttttgtgatgatgttgatcatgtgttctctgcta |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19917776 |
atactagcatttttgtgatgatgttgatcatgtgttctctgcta |
19917819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 62 - 159
Target Start/End: Original strand, 19917457 - 19917554
Alignment:
| Q |
62 |
agggatgcaaaggcactgcaggagaaaacagctaagaaagcaggtcaggatgcaggagggaataatgctggtggaagcaaaaaataggcaatgatttg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19917457 |
agggatgcaaaggcactgcaggagaaaacagctaagaaagcaggtcaggatgcaggagggaataatgctggtggaagcaaaaaataggcaatgatttg |
19917554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University