View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7116_low_38 (Length: 222)
Name: NF7116_low_38
Description: NF7116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7116_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 41993078 - 41993276
Alignment:
| Q |
20 |
ttctttagcttcttcctttgattcatggtggggtgtaaatagctgacgacttggatattatgggagagtgtaacannnnnnnnnnncacgggtagctagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41993078 |
ttctttagcttcttcctttgattcatggtggggtgtaaatagctgacggcttggatattatgggagagtgtaacatttttttttt-cacgggtagctagc |
41993176 |
T |
 |
| Q |
120 |
ctttatgtacatccgaatatcaatgaattatatcaatcaatgatt----aacgatatcaattttgtctcaaagtctattttgctcttgatattctctgct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41993177 |
ctttatgtacatccgaatatcaatgaattatatcaatcaatgattaacgaacgatatcaattttgtctcaaagtccattttgctcttgatattctctgct |
41993276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University