View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_high_11 (Length: 354)
Name: NF7117_high_11
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 197 - 340
Target Start/End: Original strand, 15135697 - 15135840
Alignment:
| Q |
197 |
gaacaactgaaggtagtttagagagtaatgcttcaagactactcattgatggagttactttcattggcataatgttgttgaaatgttcatgatatagttg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15135697 |
gaacaactgaaggtagtttagagagtaatgcttcaagactactcattgatggagttactttcattggcataatgttgttgaaatgttcatgatatagttg |
15135796 |
T |
 |
| Q |
297 |
atcattttgatgctgtggtgcaatgcttccttgaaagttatgcc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15135797 |
atcattttgatgctgtggtgcaatgcttccttgaaagttatgcc |
15135840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 19 - 139
Target Start/End: Original strand, 15135519 - 15135639
Alignment:
| Q |
19 |
taccctggcatggaactactactctcaccaacatcaagttgttcaggtctatatacctcatcttcttcgttatctaactcttctttcgcaactttttgca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15135519 |
taccctggcatggaactactactctcaccaacatcaagttgttcaggtctatatacctcatcttcttcgttatctaactcttctttcgcaactttttgca |
15135618 |
T |
 |
| Q |
119 |
ttcttccggtaaattccaatg |
139 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
15135619 |
ttcgtccggtaaattccaatg |
15135639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University