View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_high_13 (Length: 314)
Name: NF7117_high_13
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 6 - 276
Target Start/End: Complemental strand, 51210871 - 51210601
Alignment:
| Q |
6 |
atgtgaagcactctagaagtggaaagagatctttgtctgaatttgaaagttgctgccacttctcaattaacggtggcatgagaatgtcaagataaacagg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51210871 |
atgtgaagcactctagaagtggaaagagatctttgtctgaatttgaaagttgctgccacttctcaattaacggtggcatgagaatgtcaagataaacagg |
51210772 |
T |
 |
| Q |
106 |
ctgcacagaaaatagaacattggtactaaactgtgataaataactgaggagaaaagagaaaattttgggatggggaagaaggttgattagcatacctgat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51210771 |
ctgcacagaaaatagaacattggtactaaactgtgataaataactgaggagaaaagagaaaattttgggatggggaagaaggttgattagcatacctgat |
51210672 |
T |
 |
| Q |
206 |
tcagctctgccccaacagcttcagctaaagttccaacagcatcataaacaattctgaggtttcgcctctga |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51210671 |
tcagctctgccccaacagcttcagctaaagttccaacagcatcataaacaattctgaggtttcgcctctga |
51210601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 271 - 314
Target Start/End: Complemental strand, 51210568 - 51210525
Alignment:
| Q |
271 |
ctctgaccatgcatatgatgagaaggacaaaatacagtgacaat |
314 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51210568 |
ctctggccatgcatatgatgagaaggacaaaatacagtgacaat |
51210525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University