View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_high_20 (Length: 258)
Name: NF7117_high_20
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_high_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 13781608 - 13781372
Alignment:
| Q |
19 |
cagacttgaactctcttttcaaagcgaactctcttttaaatattcgagcttaatcacttgaatgaaccttaaaaagaacaacttagaatcgcttt-agaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13781608 |
cagacttgaactctcttttcaaagcagactct--tttaaatattcgagcttaatcgct--aatgaaccttaaaaagaacaacttagaatcgcttttagaa |
13781513 |
T |
|
| Q |
118 |
taactcgataattcttctatttatttaagatccaaacgacagaggaaaataaatattaaaattcattgaatcgatgtcttcttttaatttcttctgaggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13781512 |
taactcgataattcttctatttatttaagatccaaacgatagaggaaaataaatattaaaattcattgaatcgatgtcttcttttcatttcttctgaggt |
13781413 |
T |
|
| Q |
218 |
atataaattcatacgagttgtataaaaaatttaaagatttt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13781412 |
atataaattcatacgagttgtataaaaaatttaaagatttt |
13781372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University