View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_high_27 (Length: 249)
Name: NF7117_high_27
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 18960119 - 18960351
Alignment:
| Q |
1 |
tttatataaaccatgtttcatctccggtatgcccctcgtatattgttcttacacattccagcatttgtttcaacaaattttcagccatatatcaaccaat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18960119 |
tttatataaaccatgtt-catctccggtttgcccctcgtatattgttcttacacattccagcatttgtttcaacaaattttcagccatatatcaaccaac |
18960217 |
T |
|
| Q |
101 |
tttcgccgcatccgctcacatgtgtcgataaccttcatgcgcatgattctcatgcgctctgtttcaaccacgcgtgcaaggcgtctacgtgccgtccctt |
200 |
Q |
| |
|
| |||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
18960218 |
tgtcgccgcacccgctcacacgtgtcgataaccttcatgcacatgattctcatgcgctctgtttcaaccacgcgtgcaaggcgtccgtgcgccgtccctt |
18960317 |
T |
|
| Q |
201 |
tttggtgatctttacgtcggcatacttgtctcct |
234 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||||| |
|
|
| T |
18960318 |
ttcggtgatctttacgccggcatacttgtctcct |
18960351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University