View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_high_29 (Length: 245)
Name: NF7117_high_29
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 166
Target Start/End: Original strand, 8317174 - 8317321
Alignment:
| Q |
17 |
aatttaacgtttaataacggggtgattcatgttgagttcattttgccaaatgatttagtattggacttgacttcatacttggtttgttgaccagatgtag |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8317174 |
aatttaacgtttaataactgggtgattcatgttgagttcattttgccaaatgatttagtattggacttgacttcatacttggtttgttgaccagatgtag |
8317273 |
T |
 |
| Q |
117 |
atgatgttagtcttcaaatatatcatgataagtta-gggggatggttgtgt |
166 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
8317274 |
atgatgttagtcttcaaatat---atgatgagttaggggggatggttgtgt |
8317321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 8317474 - 8317545
Alignment:
| Q |
158 |
tggttgtgttgacggatcatttgagcttgataaagacaaaaatgtcataaattgtgttccatatggttttcct |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
8317474 |
tggttgtgttgacggatcatttgagcttgataaagac-aaaacgtcataaattgtgttccatatggttttcct |
8317545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University