View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_high_31 (Length: 241)
Name: NF7117_high_31
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_high_31 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 112 - 241
Target Start/End: Original strand, 13781256 - 13781385
Alignment:
| Q |
112 |
agcaagaatttatcttcttcactattattggattttgatgagcattatctaagttatcgttgaccgcagataagacaaaattttatatctgaatatataa |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13781256 |
agcaagaatttatcttcttcactgttattggattttgatgagcattatctaagttatcgttgaccgcagataagacaaaattttatatttgaatatataa |
13781355 |
T |
|
| Q |
212 |
cgtgacagagcataacaaaatctttaaatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13781356 |
cgtgacagagcataacaaaatctttaaatt |
13781385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University