View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_17 (Length: 309)
Name: NF7117_low_17
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 36264505 - 36264215
Alignment:
| Q |
1 |
taaattgtattaatttaagggtacaattaaaaaatatcaaataaacaaaagtgacaattttttgggacaatcttcttcttttacaaatatgacaattatt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36264505 |
taaattgtattaatttaaaggtacaattaaaaaatatcaaataaacaaaagtgacaattttttgggacaatcttcttcttttacaaatatgacaattatt |
36264406 |
T |
 |
| Q |
101 |
atgggatagaaatagaaggagtatatcacattggaccacaatgctatgtctagcaaacgtgcttgacgggttgggagaagaaac-nnnnnnnggtacaca |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36264405 |
atgggatagaaat---aggagtatatcacattggaccacaatgctatgtctagcaaacgtgcttgacgggttgggagaagaaacaaaaaaaaggtacaca |
36264309 |
T |
 |
| Q |
200 |
aacgtaatgaaaggggcacttctcagtattaaagcacataccaaccatagttttacctcaacttcaatgagaatcatggttacattattcagtg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36264308 |
aacgtaatgaaaggggcacttctcagtatcaaagcacataccaaccatagttttacctcaacttcaatgagaatcatggttacattattcagtg |
36264215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University