View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_21 (Length: 284)
Name: NF7117_low_21
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 22844660 - 22844412
Alignment:
| Q |
19 |
tcttctccattcgtttgaacagcagtgaaaccgccgttttgatgctttcgttggggatcctcttttctccgttcttcgtttgctggttcacgagagaaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22844660 |
tcttctccattcgtttgaacagcagtgaaaccgccgttttgatgctttcattggggatcctcttttctccgttcttcgtttgctggttcacgagagaaga |
22844561 |
T |
|
| Q |
119 |
tgtttcttcgagtgtaatttctttgattaataaccaaaccaggaatgatttgggtttgaaaacaaatttggatggggctgagctttcagttcatcatcta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22844560 |
tgtttcttcgagtgtaatttctttgattaataaccaaaccaggaatgatttggctttaaaaacaaatttggatggggctgagctttcagttcatcatcta |
22844461 |
T |
|
| Q |
219 |
acttttcgcccatcccatgcttgactactccagctttgagtgccgcttc |
267 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22844460 |
acttttcgcccatcccatgcttgattactccagctttgagtgccgcttc |
22844412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 35 - 155
Target Start/End: Complemental strand, 22833312 - 22833194
Alignment:
| Q |
35 |
gaacagcagtgaaaccgccgttttgatgctttcgttggggatcctcttttctccgttcttcgtttgctggttcacgagagaagatgtttcttcgagtgta |
134 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||| | |||||| || | ||| ||||||||||||| |
|
|
| T |
22833312 |
gaacaacagtgaaacc--cgttttgatgctttcattggggatcctcttttctcctttcttcgtttggttgttcacaagcggcgatatttcttcgagtgtg |
22833215 |
T |
|
| Q |
135 |
atttctttgattaataaccaa |
155 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
22833214 |
atttctttgattaataaccaa |
22833194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 21 - 155
Target Start/End: Complemental strand, 22824903 - 22824771
Alignment:
| Q |
21 |
ttctccattcgtttgaacagcagtgaaaccgccgttttgatgctttcgttggggatcctcttttctccgttcttcgtttgctggttcacgagagaagatg |
120 |
Q |
| |
|
|||| |||||||| |||| |||||||||| ||||||||||| ||||||||||||| ||||||||||||||||| ||| || ||||| || |||| |
|
|
| T |
22824903 |
ttctgcattcgttgaaacatcagtgaaacc--cgttttgatgcgttcgttggggatcttcttttctccgttcttcatttactttttcacaagccgtgatg |
22824806 |
T |
|
| Q |
121 |
tttcttcgagtgtaatttctttgattaataaccaa |
155 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
22824805 |
tttgttcaagtgtaatttctttgattaataaccaa |
22824771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 28 - 203
Target Start/End: Complemental strand, 22985144 - 22984965
Alignment:
| Q |
28 |
ttcgtttgaacagcagtgaaaccgccgttttgatgctttcgttggggatcctcttttctccgttcttcgtttgctggttcacgagagaagatgtttcttc |
127 |
Q |
| |
|
|||||| || ||||||||||||| ||||| |||||||| ||||| |||||||||||||| ||||| |||| || |||||| || | ||||||||| | |
|
|
| T |
22985144 |
ttcgttggatcagcagtgaaacct--gttttcatgctttctttgggaatcctcttttctccattctttgtttacttgttcacaagtggtgatgtttctcc |
22985047 |
T |
|
| Q |
128 |
gagt------gtaatttctttgattaataaccaaaccaggaatgatttgggtttgaaaacaaatttggatggggctgagctt |
203 |
Q |
| |
|
|||| ||||||||||||||||| ||||| | || ||||||||||| | | |||||||||||||||| |||||||||| |
|
|
| T |
22985046 |
gagtccgagtgtaatttctttgattaacaaccagatcaagaatgatttggctctaaaaacaaatttggatgaggctgagctt |
22984965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 22804256 - 22804191
Alignment:
| Q |
21 |
ttctccattcgtttgaacagcagtgaaaccgccgttttgatgctttcgttggggatcctcttttctcc |
88 |
Q |
| |
|
|||| |||||||| |||||||||||||||| | |||||||||||||||||||||| | |||||||| |
|
|
| T |
22804256 |
ttctgcattcgttggaacagcagtgaaaccctc--tttgatgctttcgttggggatcttattttctcc |
22804191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 29 - 91
Target Start/End: Original strand, 22804121 - 22804181
Alignment:
| Q |
29 |
tcgtttgaacagcagtgaaaccgccgttttgatgctttcgttggggatcctcttttctccgtt |
91 |
Q |
| |
|
||||| ||||| |||||||||| ||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
22804121 |
tcgttggaacatcagtgaaacct--gttttgatgcttttgttggggatcttcttttctccgtt |
22804181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University